Sequence ID | >WENV170004747 |
Genome ID | AHKK01011807 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 228 |
End posion on genome | 154 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tttttttgag |
tRNA gene sequence |
GGCGGCATAGCCAAGTGGTAAGGCAGCGGTCTGCAAAACCGCTATTCACCAGTTCGAATC |
Downstream region at tRNA end position |
cataattttg |
Secondary structure (Cloverleaf model) | >WENV170004747 Cys GCA g TCCA cataattttg G - C G - C C - G G - C G - C C - G A - T T A T T G G T C A G A A | | | | | G T A C C G A C C A G C G | | | T T G A G G C T A A TATTC G - C C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |