Sequence ID | >WENV170004748 |
Genome ID | AHKK01011936 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 339 |
End posion on genome | 414 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gtttatttat |
tRNA gene sequence |
TCCCCAGTAGCTCAGTTGGCAGAGCGAGTGGCTGTTAACCACTAAGTCCGCGGTTCGAGT |
Downstream region at tRNA end position |
acaaattatt |
Secondary structure (Cloverleaf model) | >WENV170004748 Asn GTT t GCCA acaaattatt T - A C - G C - G C - G C - G A - T G - C T G T G T G C C A T G A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C C A G AAGTC A - T G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |