Sequence ID | >WENV170004749 |
Genome ID | AHKK01011973 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 329 |
End posion on genome | 413 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cggaaagttT |
tRNA gene sequence |
GCGGGGGTTGCCAAGAGGACAAAGGCGCAGCGTTGAGGTCGCTGTCCCGTAGGGGTTCGA |
Downstream region at tRNA end position |
aaacttataa |
Secondary structure (Cloverleaf model) | >WENV170004749 Leu GAG T ATta aaacttataa G - C C - G G - C G - C G + T G - C G - C T A T C T C C C A A G A T | | | | | A G A C C G G A G G G C G | | | T T A A G G C C A A G TCCCGTAGGGGTTC C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |