Sequence ID | >WENV170004752 |
Genome ID | AHKK01012283 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 3856 |
End posion on genome | 3783 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taataacact |
tRNA gene sequence |
GCCCCGGTAGCTTAGCTTGGATGAGCGATTGACTTGTAATCAGTAGGTCGAGGGTTCAAA |
Downstream region at tRNA end position |
tttctacgtc |
Secondary structure (Cloverleaf model) | >WENV170004752 Thr TGT t Tttc tttctacgtc G - C C - G C - G C - G C - G G - C G - C T A T C T C C C A C G A A | | | | | A T T T C G G A G G G C T + | | | T T G G A G C G A T G AGGTC A - T T + G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |