Sequence ID | >WENV170004753 |
Genome ID | AHKK01012305 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 206 |
End posion on genome | 278 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
taaagaggga |
tRNA gene sequence |
AGTCCCGTGGTGTAGCGGTCAAGCATACCGGCCTTTGGAGCCTGTGACAGGGGTTCGAAT |
Downstream region at tRNA end position |
cctgtcattt |
Secondary structure (Cloverleaf model) | >WENV170004753 Gln TTG a Atct cctgtcattt A - T G - C T - A C - G C - G C - G G - C T A T T C T C C A C G A G | | + | | G G T G T G A G G G G C G + | | + T T T G C A T C A A A TGAC C - G C T G - C G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |