| Sequence ID | >WENV170004757 |
| Genome ID | AHKK01012634 |
| Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
| Species | |
| Start position on genome | 1940 |
| End posion on genome | 2014 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
gtagcaggaT |
| tRNA gene sequence |
GGGCCGGTAGATCAGTTGGAAGATCACTCGCTTGGCGTGCGAGAGGCCTCGGGTTCAAAT |
| Downstream region at tRNA end position |
tggcatgggc |
| Secondary structure (Cloverleaf model) | >WENV170004757 Ala GGC
T ATta tggcatgggc
G - C
G - C
G + T
C - G
C - G
G - C
G - C T A
T A G C C C A
T G A A | | | | | A
T C T A G T C G G G C
G | | | | T T
G G A T C
A A A AGGCC
C - G
T - A
C - G
G - C
C - G
T T
T G
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |