Sequence ID | >WENV170004759 |
Genome ID | AHKK01012873 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 239 |
End posion on genome | 324 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
caaagaagcg |
tRNA gene sequence |
GCCGAGGTAGCTTAGCGGACTAAAGCGCCGGCCTTGAGAGCCGGTGTCCCACAAGGGACA |
Downstream region at tRNA end position |
gctcagggta |
Secondary structure (Cloverleaf model) | >WENV170004759 Ser TGA g Gttc gctcagggta G - C C - G C - G G - C A - T G - C G - C T A T T T C C C A C G A A | + | | | G G T T C G A G G G G C G | | | | T T A A A G C C T A G TGTCCCACAAGGGACAC C - G C - G G - C G - C C - G C A T G T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |