Sequence ID | >WENV170004764 |
Genome ID | AHKK01013039 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 4954 |
End posion on genome | 5030 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gaaagtttgA |
tRNA gene sequence |
GCCAAGGTGGCGGAGAGGCACACGCGGCTGACTGCAGATCAGCTATACCCCGGTTCAAAT |
Downstream region at tRNA end position |
ttggttatac |
Secondary structure (Cloverleaf model) | >WENV170004764 Cys GCA A TTCC ttggttatac G - C C - G C - G A - T A - T G - C G - C T A T G G G C C A A G A G | | | | | A G G G C G C C C G G C G | | | T T C A C G C A C G TATAC G - C C - G T - A G - C A - T C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |