Sequence ID | >WENV170004909 |
Genome ID | AJWY01013499 |
Search identical group | |
Phylum/Class | [AJWY] human gut metagenome; lean human gut |
Species | |
Start position on genome | 545 |
End posion on genome | 619 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggatgcaaaa |
tRNA gene sequence |
GGACCCATAGCTCAGTCGGTTAGAGCAGCGGACTCATAATCCGAAGGTCGTGGGATCATG |
Downstream region at tRNA end position |
gaaagtcagg |
Secondary structure (Cloverleaf model) | >WENV170004909 Met CAT a ACtt gaaagtcagg G - C G - C A - T C - G C - G C - G A - T C G T C T C C C T T G A A | | | | A C C T C G G T G G G C G | | | | A T G G A G C T T A A AGGTC G A C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |