Sequence ID | >WENV170006355 |
Genome ID | AMWB02017917 |
Search identical group | |
Phylum/Class | [AMWB] bioreactor metagenome; anode biofilm in microbial fuel cells |
Species | |
Start position on genome | 67029 |
End posion on genome | 67105 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aagttggatg |
tRNA gene sequence |
GTGGGCGTAGCTCAGCTGGTGGTAGCTTCGGATTGTGGCTCCGACGGTCGTGGGTTCAAG |
Downstream region at tRNA end position |
ttctatttta |
Secondary structure (Cloverleaf model) | >WENV170006355 His GTG g CCCA ttctatttta G - C T - A G - C G + T G - C C - G G - C T G T T A C C C A C G A A + | | | | A T C T C G G T G G G C G | | | T T G T A G C T G G T CGGTC T - A C - G G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |