Sequence ID | >WENV170006357 |
Genome ID | AMWB02017917 |
Search identical group | |
Phylum/Class | [AMWB] bioreactor metagenome; anode biofilm in microbial fuel cells |
Species | |
Start position on genome | 77349 |
End posion on genome | 77275 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tattttaaac |
tRNA gene sequence |
TGGGGCGTCGTCAAGCGGTAAGACACAAGACTTTGACTCTTGCATTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tttgcttcat |
Secondary structure (Cloverleaf model) | >WENV170006357 Gln TTG c GCCA tttgcttcat T - A G - C G - C G - C G - C C - G G - C T A T C G T C C A G A C | + | | | G C A C T G G T A G G C G | | | T T G A G A C T A A CATTC C - G A - T A - T G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |