Sequence ID | >WENV170008193 |
Genome ID | AMZC01004125 |
Search identical group | |
Phylum/Class | [AMZC] bioreactor sludge metagenome; anaerobic thermophilic cellulolytic sludge from lab reactor |
Species | |
Start position on genome | 2285 |
End posion on genome | 2360 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
attcaatcat |
tRNA gene sequence |
GCCTCGATAGCTTAGGTGGTAGAGCGCGGGATTCGTAATCCCGAGGTCGCGGGTTCAATC |
Downstream region at tRNA end position |
tttttttcat |
Secondary structure (Cloverleaf model) | >WENV170008193 Thr CGT t TCTA tttttttcat G - C C - G C - G T + G C - G G - C A - T C T T C G C C C A G G A A | | | | | A T T T C G G C G G G C G + | | | T T G G A G C T A G AGGTC C - G G - C G - C G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |