| Sequence ID | >WENV170008263 |
| Genome ID | AMZC01006470 |
| Phylum/Class | [AMZC] bioreactor sludge metagenome; anaerobic thermophilic cellulolytic sludge from lab reactor |
| Species | |
| Start position on genome | 152 |
| End posion on genome | 238 |
| Amino Acid | Leu |
| Anticodon | CAG |
| Upstream region at tRNA start position |
tttaaaaaat |
| tRNA gene sequence |
ACCCGAGTGGCGGAATTGGTAGACGCGCTAGTTTCAGGGACTAGTGTCCTTTCGGACGTG |
| Downstream region at tRNA end position |
gatagccctg |
| Secondary structure (Cloverleaf model) | >WENV170008263 Leu CAG
t ACAA gatagccctg
A - T
C - G
C - G
C - G
G - C
A - T
G - C T G
T T G T C C A
T A A G + | | | | A
T G G C G G C A G G C
G | | | T T
G A C G C
T A G G TGTCCTTTCGGACGT
C - G
T - A
A - T
G - C
T - A
T G
T G
C A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |