| Sequence ID | >WENV170008836 |
| Genome ID | APHM01009297 |
| Phylum/Class | [APHM] hypersaline lake metagenome; filtered surface water from Lake Tyrrell |
| Species | |
| Start position on genome | 1298 |
| End posion on genome | 1373 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
tgtgttttga |
| tRNA gene sequence |
GGTCAGGTAGCTCAGGTGGTAGAGCAACGGCCTGAAAAGCCGTGTGTCGGCGGTTCGAAT |
| Downstream region at tRNA end position |
cgcccccgct |
| Secondary structure (Cloverleaf model) | >WENV170008836 Phe GAA
a ACCC cgcccccgct
G - C
G - C
T - A
C - G
A - T
G - C
G - C T A
T C C G C C A
G G A A | | | | | G
T C T C G G G C G G C
G | | | | T T
G G A G C
T A A GTGTC
A - T
C - G
G - C
G - C
C - G
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |