Sequence ID | >WENV170009702 |
Genome ID | APMI01001999 |
Search identical group | |
Phylum/Class | [APMI] wastewater metagenome; sequencing batch reactors (SBR) enriched microbial communities from a Danish wastwater |
Species | |
Start position on genome | 819 |
End posion on genome | 735 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgcttcccat |
tRNA gene sequence |
GCCGGGATGGCGGAATCGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCAAGGTGTGAG |
Downstream region at tRNA end position |
ataaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170009702 Leu CAA t ACCA ataaaatcaa G - C C - G C - G G - C G - C G - C A - T T G T C T C C C A T A A G | | | | | G C G G C G G A G G G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |