| Sequence ID | >WENV170011005 |
| Genome ID | APMI01038993 |
| Phylum/Class | [APMI] wastewater metagenome; sequencing batch reactors (SBR) enriched microbial communities from a Danish wastwater |
| Species | |
| Start position on genome | 1539 |
| End posion on genome | 1463 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
gcccaccgac |
| tRNA gene sequence |
CGGGGTATGGCGCAGTTTGGTAGCGCGTCCGCTTTGGGAGCGGAAGGCCGTCGGTTCGAA |
| Downstream region at tRNA end position |
tctggtccgg |
| Secondary structure (Cloverleaf model) | >WENV170011005 Pro TGG
c ACCA tctggtccgg
C - G
G - C
G - C
G - C
G - C
T - A
A - T T A
T C G G C C A
T G A G | + | | | G
T C G C G G T C G G C
T | | | | T T
G G C G C
G T A G AGGCC
T - A
C - G
C - G
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |