Sequence ID | >WENV170012426 |
Genome ID | ASRJ01001636 |
Phylum/Class | [ASRJ] food metagenome; kefir grains from a family living in the Northwest region of Turkey and cultivating the kefir |
Species | |
Start position on genome | 820 |
End posion on genome | 903 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acaatctttT |
tRNA gene sequence |
GGCGTTGTGATCCAGTGGCAACGATAGCGGTCTGTAAAACCGCCGGTATTTACCTTCGTA |
Downstream region at tRNA end position |
tcgccttaag |
Secondary structure (Cloverleaf model) | >WENV170012426 Tyr GTA T ATtg tcgccttaag G - C G - C C - G G - C T - A T - A G - C T G T C A T T C A T G A G | | | | | G G C C T A G T A A G C G | | | T T C C G A T A A A CGGTATTTACCTTC G - C C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |