Sequence ID | >WENV170012437 |
Genome ID | ASRK01000059 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 23942 |
End posion on genome | 23854 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ataatagtgt |
tRNA gene sequence |
AGAGAGTTGACAGAGTTGGTCGAATGTACCGGTTTTGAAAACCGGCGAGGTTAACGCCTC |
Downstream region at tRNA end position |
cttttattac |
Secondary structure (Cloverleaf model) | >WENV170012437 Ser TGA t GCCA cttttattac A - T G - C A - T G - C A - T G - C T - A T A T C C C C C A T T G A G | | | | | G G G A C A G G G G G C G | | | T T T A T G T C G A A CGAGGTTAACGCCTCC C - G C - G G - C G - C T - A T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |