Sequence ID | >WENV170012440 |
Genome ID | ASRK01000089 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 17668 |
End posion on genome | 17743 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tttacgaaat |
tRNA gene sequence |
GGCTCGGTAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGACGGTTCGATT |
Downstream region at tRNA end position |
tgtaatttag |
Secondary structure (Cloverleaf model) | >WENV170012440 Phe GAA t ACCA tgtaatttag G - C G - C C - G T C C - G G - C G - C T T T C C G C C A T G A A | | | | G T C T C G G A C G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |