Sequence ID | >WENV170012442 |
Genome ID | ASRK01000097 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 9713 |
End posion on genome | 9800 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgtcagaaaT |
tRNA gene sequence |
GCGGATGTGGCGGAATTGGCAGACGCACAGGACTCAAAATCCTGCGGTAGTGATATCGTG |
Downstream region at tRNA end position |
aagcttgtat |
Secondary structure (Cloverleaf model) | >WENV170012442 Leu CAA T ATCA aagcttgtat G - C C - G G - C G - C A - T T - A G - C T C T C A C C C A T A A G | | | | | G T G G C G G T G G G C G | | | T T G A C G C C A G A CGGTAGTGATATCGT C - G A - T G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |