Sequence ID | >WENV170012443 |
Genome ID | ASRK01000117 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 14780 |
End posion on genome | 14855 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
caatctcaat |
tRNA gene sequence |
GACCCTGTCGTCTAGTGGCCAAGGACCTCAGGATTTCCTCCTGATGACGCAAGTTCAAAT |
Downstream region at tRNA end position |
accannnnnn |
Secondary structure (Cloverleaf model) | >WENV170012443 Glu TTC t GCCA accannnnnn G - C A - T C - G C - G C - G T + G G + T T A T C G T T C A T G A C | | | | | A G T C T G G C A A G C G + | | | T T C G G A C C A A C TGAC T - A C - G A - T G - C G - C A T T C T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |