Sequence ID | >WENV170012444 |
Genome ID | ASRK01000119 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 14288 |
End posion on genome | 14375 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tcattgataT |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTTTAAGGAGCTGGTCTTGAAAACCAGTGACTCCGAAAGGGGC |
Downstream region at tRNA end position |
tcaaaaccac |
Secondary structure (Cloverleaf model) | >WENV170012444 Ser TGA T GTta tcaaaaccac G - C G - C A - T G - C A - T G + T G - C T A T C A C C C A T G A G | | | | | G G G C C T G T G G G C G | | | T T T A G G A T T A G TGACTCCGAAAGGGGCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |