Sequence ID | >WENV170012447 |
Genome ID | ASRK01000224 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 8573 |
End posion on genome | 8647 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tttactatat |
tRNA gene sequence |
GCGTGAGTGGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
acggaagttc |
Secondary structure (Cloverleaf model) | >WENV170012447 Gly GCC t TCTA acggaagttc G - C C - G G - C T + G G - C A - T G - C T A T T G C C C A G A G + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |