Sequence ID | >WENV170012450 |
Genome ID | ASRK01000302 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4450 |
End posion on genome | 4537 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcgttgaaag |
tRNA gene sequence |
GGAGGAGTGGCCGAGTGGTTGAAGGCAACGGTCTTGAAAACCGTCGATGGGCGACTATCC |
Downstream region at tRNA end position |
aatttaaaac |
Secondary structure (Cloverleaf model) | >WENV170012450 Ser TGA g GCCA aatttaaaac G - C G - C A - T G - C G - C A - T G - C T A T C A C T C A T G A G | | | | | G G G C C G G T G A G C G | | | T T T A G G C T G A A CGATGGGCGACTATCC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |