Sequence ID | >WENV170012454 |
Genome ID | ASRK01000374 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4347 |
End posion on genome | 4420 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
taatggttca |
tRNA gene sequence |
GGGAGTATAGCTCAGCTGGTTAGAGTGCTTGCTTGACATGCAAGAGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
aaagcctgtt |
Secondary structure (Cloverleaf model) | >WENV170012454 Val GAC a Ataa aaagcctgtt G - C G - C G - C A G G - C T - A A - T C A T T G A C C A C G A A + | | | | G T C T C G G C T G G C G | | | + T T G G A G T T T A G AGGTC C - G T - A T - A G - C C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |