Sequence ID | >WENV170012455 |
Genome ID | ASRK01000533 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 3615 |
End posion on genome | 3544 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
TGGGCATTCGCCAAGCGGTAAGGCACAGGACTTTGACTCCTGCATTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
tagctgtaat |
Secondary structure (Cloverleaf model) | >WENV170012455 Gln TTG n Gtta tagctgtaat T - A G - C G - C G - C C - G A - T T - A T A T C G A C C A G A C | | | | | G C A C C G G C T G G C G | | | T T G A G G C T A A CATTC C - G A - T G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |