Sequence ID | >WENV170012463 |
Genome ID | ASRK01000772 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1353 |
End posion on genome | 1277 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctgcaactgg |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCAGGGGACTCATAATCCCTTGGTCCACGGTTCAAG |
Downstream region at tRNA end position |
tttttaaagc |
Secondary structure (Cloverleaf model) | >WENV170012463 Met CAT g ACCA tttttaaagc G - C G - C G - C C - G C - G T - A G - C T G T G T G C C A T G A A | | | | | A T C T C G C A C G G C G | | | | T T G G A G C T T A A TGGTC G + T G - C G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |