Sequence ID | >WENV170012464 |
Genome ID | ASRK01000972 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 295 |
End posion on genome | 370 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggccgccatt |
tRNA gene sequence |
GCCGGTATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCCGAGTTCGACT |
Downstream region at tRNA end position |
cattaaagtc |
Secondary structure (Cloverleaf model) | >WENV170012464 Thr TGT t ACCA cattaaagtc G - C C - G C - G G - C G - C T + G A - T T C T G G T T C A T G A A | | + | | G T C T C G C C G A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |