Sequence ID | >WENV170012465 |
Genome ID | ASRK01000981 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1848 |
End posion on genome | 1762 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gattagtttt |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGTAGACACGCTACCTTGAGGTGGTAGTGGCCAGTAGGCTGTA |
Downstream region at tRNA end position |
attacaaaac |
Secondary structure (Cloverleaf model) | >WENV170012465 Leu GAG t ACCA attacaaaac G + T C - G C - G G - C A - T G - C G - C T G T T C C C C A T A A G | | | | | G T G G T G A G G G G C G | | | T T G A C A C T A G G TGGCCAGTAGGCTGT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |