Sequence ID | >WENV170012467 |
Genome ID | ASRK01001495 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 103 |
End posion on genome | 16 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
acacaaattc |
tRNA gene sequence |
GGTGAGTTGTCCGAGTGGCTGAAGGAGCTCGCCTGGAAAGCGTGTATACGGCAACGTATC |
Downstream region at tRNA end position |
catcaaaaac |
Secondary structure (Cloverleaf model) | >WENV170012467 Ser GGA c GCCA catcaaaaac G - C G - C T - A G - C A - T G - C T - A T A T C T C T C A T G A G | | | | | G G G C C T G A G A G C G | | | T T C A G G A T G A G TATACGGCAACGTATC C - G T T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |