Sequence ID | >WENV170012468 |
Genome ID | ASRK01001581 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1635 |
End posion on genome | 1559 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cagcctcaac |
tRNA gene sequence |
GCTCCGTTAGCTCAGCTGGATAGAGCACCCGCCTTCTAAGCGGGTGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
aatttaaaaa |
Secondary structure (Cloverleaf model) | >WENV170012468 Arg TCT c ACCA aatttaaaaa G + T C - G T - A C - G C - G G - C T - A T A T C G T C C A C G A A | | | | | A T C T C G G C A G G C G | | | | T T G G A G C A T A A TGGTC C - G C - G C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |