Sequence ID | >WENV170012469 |
Genome ID | ASRK01001746 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1372 |
End posion on genome | 1296 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
atgccctaat |
tRNA gene sequence |
CGGATGCTAGCGCAGTTTGGTAGCGCACTACTCTGGGGGAGTAGGGGTCAGCGGTTCGAA |
Downstream region at tRNA end position |
catcactcac |
Secondary structure (Cloverleaf model) | >WENV170012469 Pro GGG t ACCA catcactcac C - G G - C G - C A - T T - A G - C C - G T A T T C G C C A T G A A | | | | | G T C G C G A G C G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A A - T C - G T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |