Sequence ID | >WENV170012470 |
Genome ID | ASRK01001777 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1350 |
End posion on genome | 1264 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tccgcgccat |
tRNA gene sequence |
GCCTCGGTGGCGGAATTGGTAGACGCAGCGGATTCAAAATCCGCCGTTGGTAACAACGTG |
Downstream region at tRNA end position |
agttatttag |
Secondary structure (Cloverleaf model) | >WENV170012470 Leu CAA t ACCA agttatttag G - C C - G C - G T - A C - G G - C G - C T T T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G A CGTTGGTAACAACGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |