Sequence ID | >WENV170012472 |
Genome ID | ASRK01001792 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1213 |
End posion on genome | 1299 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cgcttctacc |
tRNA gene sequence |
GCCCGGATGGCGGAATAGGTAGACGCAAGGGACTTAAAATCCCTCGGTGGTAACACCGTG |
Downstream region at tRNA end position |
tatataacaa |
Secondary structure (Cloverleaf model) | >WENV170012472 Leu TAA c ACCA tatataacaa G - C C - G C - G C - G G - C G - C A - T T T T C G G C C A T A A G | | | | | G A G G C G G C C G G C G | | | T T G A C G C T A G A CGGTGGTAACACCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |