Sequence ID | >WENV170012474 |
Genome ID | ASRK01001820 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 148 |
End posion on genome | 75 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gagatacaac |
tRNA gene sequence |
GGCGCGTTGGCAGAGAGGCTATGCAGCGGATTGCAAATCCGTGGACCTCGGTTCGATTCC |
Downstream region at tRNA end position |
ttcctttatg |
Secondary structure (Cloverleaf model) | >WENV170012474 Cys GCA c TCCA ttcctttatg G - C G - C C - G G - C C - G G - C T - A T T T G G G C C A G A G | + | | | G A G A C G C T C G G C G | | | T T G A T G C C T A GGAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |