Sequence ID | >WENV170012482 |
Genome ID | ASRK01003157 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 102 |
End posion on genome | 175 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttttcgttta |
tRNA gene sequence |
GGCCGAGTGGTAGAGTGGTTATGCAGCGGATTGCAAATCCGTGAACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
atttaaaagc |
Secondary structure (Cloverleaf model) | >WENV170012482 Cys GCA a TCCA atttaaaagc G - C G - C C - G C - G G - C A - T G - C T T T C G G C C A G A G | | | | | G T G A T G G C C G G C G | + | T T G A T G C T T A GAAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |