Sequence ID | >WENV170012488 |
Genome ID | ASRK01005438 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 511 |
End posion on genome | 587 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gatggggcat |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGTTGGCCTCCGGAGCCAAAGGTCGAAGGTTCGAA |
Downstream region at tRNA end position |
aattccggaa |
Secondary structure (Cloverleaf model) | >WENV170012488 Arg CCG t ACCA aattccggaa G - C C - G G - C C - G C - G C - G G - C T A T T T T C C A C G A A + | | | | G T C T C G G A A G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |