Sequence ID | >WENV170012490 |
Genome ID | ASRK01006731 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 425 |
End posion on genome | 350 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cagacaaaaa |
tRNA gene sequence |
GTCCCCTTAGTTCAGCTGGATAGAACAAGGACCTCCTAAGTCTTAGACACAGGTTCGAAT |
Downstream region at tRNA end position |
tttcttctgt |
Secondary structure (Cloverleaf model) | >WENV170012490 Arg CCT a ACCA tttcttctgt G - C T - A C - G C - G C - G C - G T - A T A T T G T C C A C G A A | | | | | G T C T T G A C A G G C G | | | | T T G G A A C A T A A AGAC A - T G + T G - C A - T C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |