Sequence ID | >WENV170012491 |
Genome ID | ASRK01006787 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 157 |
End posion on genome | 231 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tcaacgatgt |
tRNA gene sequence |
GCGTGCATCGTATAATGGCTATTACCTCAGCCTTCCAAGCTGATGATGTGGGTTCGATTC |
Downstream region at tRNA end position |
agttgtctct |
Secondary structure (Cloverleaf model) | >WENV170012491 Gly TCC t TCCA agttgtctct G - C C - G G - C T - A G - C C - G A - T T T T C A C C C A T A A C | | | | | G G T A T G G T G G G C G | | | T T C T T A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |