Sequence ID | >WENV170012494 |
Genome ID | ASRK01008192 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 102 |
End posion on genome | 178 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aagcaaaaat |
tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCGCTCGCCTGATAAGCGGGAGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
aactctcctt |
Secondary structure (Cloverleaf model) | >WENV170012494 Ile GAT t ACCA aactctcctt G - C G - C G - C T - A C - G T - A G - C T G T T C A C C A C G A A + | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G T + G C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |