Sequence ID | >WENV170012498 |
Genome ID | ASRK01009070 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 323 |
End posion on genome | 238 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agaattgcgt |
tRNA gene sequence |
GCCCTGGTGGTGGAATTGGTAGACACAAGGGATTTAAAATCCCTCGGCTTATGGCTGTGC |
Downstream region at tRNA end position |
tcttttaaag |
Secondary structure (Cloverleaf model) | >WENV170012498 Leu TAA t ACCA tcttttaaag G - C C - G C - G C - G T + G G - C G - C T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G A CGGCTTATGGCTGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |