| Sequence ID | >WENV170012499 |
| Genome ID | ASRK01009374 |
| Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
| Species | |
| Start position on genome | 315 |
| End posion on genome | 239 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
nnnnnnnntt |
| tRNA gene sequence |
CGGTGAATAGCGCAGCTTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGGGGTTCGAA |
| Downstream region at tRNA end position |
tatttaatga |
| Secondary structure (Cloverleaf model) | >WENV170012499 Pro TGG
t ACCA tatttaatga
C - G
G - C
G - C
T - A
G - C
A - T
A - T T A
T C T C C C A
C G A A | + | | | G
T C G C G G G G G G C
T | | | | T T
G G C G C
G T A A GGGTC
T - A
C - G
T - A
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |