Sequence ID | >WENV170012500 |
Genome ID | ASRK01009374 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 87 |
End posion on genome | 12 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
acttttagtg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGCCCTGGATTGTGATTCCGGTTGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
tttatttaaa |
Secondary structure (Cloverleaf model) | >WENV170012500 His GTG g CCCA tttatttaaa G - C T - A G - C G - C C - G T - A A - T T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A C TTGTC C - G T + G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |