Sequence ID | >WENV170012503 |
Genome ID | ASRK01009782 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 165 |
End posion on genome | 241 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgatttagat |
tRNA gene sequence |
GGCTACGTAGCTCAGCTGGTTAGAGCACATCACTCATAATGATGGGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
taattaaaac |
Secondary structure (Cloverleaf model) | >WENV170012503 Met CAT t ACCA taattaaaac G - C G - C C - G T - A A - T C - G G - C T A T T G C C C A C G A A | | | | A T C T C G A C A G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T T - A C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |