Sequence ID | >WENV170012505 |
Genome ID | ASRK01010365 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 192 |
End posion on genome | 267 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
caaacaatgt |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGGAGAGCACCTCCCTTACAAGGAGGGGGTCACTGGTTCGAGC |
Downstream region at tRNA end position |
tnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012505 Val TAC t ACCA tnnnnnnnnn G - C G - C G - C C - G G - C A - T T - A C G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |