Sequence ID | >WENV170012509 |
Genome ID | ASRL01000005 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 13955 |
End posion on genome | 14039 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tttctcaaac |
tRNA gene sequence |
GCGACCGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGCCTTAGGGTGTACG |
Downstream region at tRNA end position |
ttgattttta |
Secondary structure (Cloverleaf model) | >WENV170012509 Leu GAG c ACCA ttgattttta G - C C - G G - C A - T C - G C - G G - C T A T T G C T C A T A A G | | | | | A T A G T G A C G A G C G | | | T T G A C A C T A G G TGCCTTAGGGTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |