Sequence ID | >WENV170012514 |
Genome ID | ASRL01000026 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 36041 |
End posion on genome | 35965 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttaattttaa |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGCACCCGCCTTCTAAGCGGGTGGCCACTGGTTCGAG |
Downstream region at tRNA end position |
aatccttcat |
Secondary structure (Cloverleaf model) | >WENV170012514 Arg TCT a GCCA aatccttcat G - C C - G G - C C - G C - G C - G G - C T G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C A T A A TGGCC C - G C - G C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |