Sequence ID | >WENV170012528 |
Genome ID | ASRL01000183 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 10903 |
End posion on genome | 10975 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tattgaagat |
tRNA gene sequence |
GCTCCCATGGCTCAGTCGGTAGAGCGATTCACTCGTAATGAATAGGTCAGCGGTTCGATT |
Downstream region at tRNA end position |
tcctttatac |
Secondary structure (Cloverleaf model) | >WENV170012528 Thr CGT t Tttt tcctttatac G - C C - G T - A C - G C - G C - G A - T T T T T C G C C A T G A G | | | | | G C C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC A - T T - A T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |