Sequence ID | >WENV170012529 |
Genome ID | ASRL01000254 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 9304 |
End posion on genome | 9218 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctttcagtat |
tRNA gene sequence |
GCCCAGGTGGTGAAATTGGTAGACACGCTAGCTTCAGGTGCTAGTGCTCGCAAGGGCGTG |
Downstream region at tRNA end position |
attattatac |
Secondary structure (Cloverleaf model) | >WENV170012529 Leu CAG t ACCA attattatac G - C C - G C - G C - G A - T G - C G - C T G T T C T T C A T A A G + | | | | G T A G T G G G A A G C G | | | T T G A C A C T A G G TGCTCGCAAGGGCGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |