Sequence ID | >WENV170012535 |
Genome ID | ASRL01000367 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 95 |
End posion on genome | 5 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atttcagttT |
tRNA gene sequence |
GGAGAAGTACTCAAGTGGCTGAAGAGGTGCCCCTGCTAAGGGTATAGGTCGTTAATAGCG |
Downstream region at tRNA end position |
gtnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012535 Ser GCT T GTta gtnnnnnnnn G - C G - C A - T G - C A - T A - T G - C T A T C T C C C A T G A A | | | | | A G A C T C G A G G G C G | | | T T C A G A G T G A G TAGGTCGTTAATAGCGGCGC T - A G + T C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |